alsT [2018-10-27 17:34:46]

putative glutamine transporter

Locus: BSU18120

Isoelectric point: 9.39

Molecular weight: 50.14 kDa

Protein length: 465 aa

Gene length: 1395 bp

Function: uptake of glutamine

Product: putative glutamine transporter

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → Transporters/ other → Amino acid transporters → Solute:sodium symporter family
• Cellular processes → Transporters → Transporters/ other → Amino acid transporters → Alanine or glycine cation symporter family
• Metabolism → Amino acid/ nitrogen metabolism → Biosynthesis/ acquisition of amino acids → Biosynthesis/ acquisition of glutamate/ glutamine/ ammonium assimilation
• Metabolism → Amino acid/ nitrogen metabolism → Utilization of amino acids → Utilization of glutamine/ glutamate
• Groups of genes → Membrane proteins

Gene

Coordinates: 1,938,925 → 1,940,322

The protein

Protein family

• sodium:alanine (SAF) symporter family (according to Swiss-Prot)

Paralogous protein(s)

• GlnT, YrbD, YflA

Localization

• cell membrane (according to Swiss-Prot), membrane PubMed

Expression and Regulation

Operons

• Genes: alsT
  Description: PubMed

  Regulatory mechanism

  • TnrA: repression, PubMed, in TnrA regulon
  • GlnR: repression, PubMed, in GlnR regulon

  Regulation

  • repressed in the absence of good nitrogen sources (glutamine or ammonium) (tnrA) PubMed
  • repressed in the presence of glutamine (GlnR) PubMed

Biological materials

Mutant

• GP1888 (tet) available in Jörg Stülke's lab
• BKE18120 (ΔalsT::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATTTACCTCCCGTTTTC, downstream forward: _UP4_TAATATAAATATAAAACAAA
• BKK18120 (ΔalsT::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATTTACCTCCCGTTTTC, downstream forward: _UP4_TAATATAAATATAAAACAAA

References

Loading